Translated material
"Difficulty is a disease"
Colta.ru, together with the “Book Projects of Dmitry Zimin”, is launched a new large project. We meet with Nobel laureates - real and future. We talk, listen, try to figure out how everything works from the point of view of modern great science.
Our first interlocutor is one of the most famous specialists in the field of computer and evolutionary biology Evgeny Kunin. So, the heading "Big Science": we start.
Diligent popularizers love to certainly report about DNA that this is a “chain of letters”. Often for clarity, a piece of chain - for example, TAAGTTTATTTATATACTTTTAA ... - they bring nearby and explain: like an abracadabra, but in it (you will not believe, emphasize diligent popularizers) human qualities with you and you are encrypted.
The human genome was deciphered-in the sense that they were able to record it in the form of such a chain with a length of three billion signs-in 2003, and the black version was published in the journal Nature in 2001. Among the authors of this work are Evgeny Kunin, an American researcher who emigrated from the USSR back in 1991. Sitting in his office in the city of Betesda, Maryland, he shows a finger at the image of a double spiral DNA under glass composed of portraits of scientists: “I have a letter that was issued to everyone who participated.” This study is then quoted in other scientific works at least 19,836 times ( Google Scholar collects statistics), and a total of 134,000 times were sent to Kunin’s work, and numbers grow further. He is the most cited of biologists who have ever worked in Russia.
Kunin is 60 years old, he was just elected to the US National Academy of Sciences, but he is least like an academician, which we used to imagine them from the photo from annual sessions of the Russian Academy of Sciences. In an official group picture, he poses in jeans and a T -shirt with the inscription "Rio" and walks a jumping gait of a teenager.
Where others see the letters, Kunin sees something more complicated. In his description of the DNA device, “dark matter” (the term from cosmology) and “support-plastic” (the term from the theory of cross-domed architecture), the “hypothesis of the Red Queen” and the “bureaucratic ceiling of complexity” are found. All this could be mistaken for the lyrics and an attempt to explain more out of explanation if each of such a phrase was not in each case one or another strict abstract principle, for which more mundane metaphors had not yet been able to come up with.
Professional interest in letters suggests that for any text it is useful to find out the history of its birth, and DNA is no exception. Her story is four billion years of evolution of all living things, when fragments of the genetic text were shuffled, duplicated, spoiled during copying, borrowed by people in viruses and viruses at bacteria, disappeared and appeared: in fact, this evolution is. Kunin reduces all his work as a biologist to the answer to the question of what drives it. “Understand evolution. For me, there are no other tasks for me, ”he says without any pathos.
Kunin leads a large research group at the US National Institutes of the United States. This is a state agency that spends $ 30 billion a year on medical and biological studies (that is, about 180 annual budgets of Moscow State University), with a headquarters of 20 minutes from the Washington Center: during this time you have time to leave the city and be in the neighboring state of Maryland. There is a National Institute of Management and the National Institute of Cancer, the National Institute of Narcology and the National Institute of Biomedical images and bioenginery. In order to make an idea of the scale: national health institutions have its own separate radio station, which tells exclusively about transport problems on the territory of the campus and on the entrances to it.
Why evolution to the medical center? The most common answer to this question is Kunin’s beloved quote from the theodosius of Dobzhansky, the classic of genetics: “Nothing in biology makes sense except in the light of evolution.” Any knowledge that at least indirectly uses the ideas about DNA and mutations - that is, in general, all modern medical knowledge is based on the theory of evolution as a mandatory foundation. It is even easier to say that the stability of bacteria to antibiotics and mutations leading to cancer are direct illustrations to how evolution works.
But these are all old and long -known facts. Is there anything more? In 2015, Science magazine called a breakthrough of the year the CRISPR-CAS9 system, which is called "molecular scissors" for DNA. It allows you to point a defective piece from the genome point and also insert a new fragment pointwise. “In the near future - for not decades, namely a few years - this will come to hospitals. To begin with, they will be treated for diseases that are associated with mutations in one gene, ”Kunin explains. It is called one of the fathers of the method, although he himself did not seek any medical application of his discovery: “This, so to speak, is a by -product. Of course, no one will throw him away. ”
In 2006, Kunin tried to figure out where in the DNA of bacteria regularly repeated groups of letters - and why areas of DNA between repetitions resemble DNA of viruses that can infect them (bacteria, like people, suffer from viral infections). The decision that came to his mind was like this: these pieces of DNA are trophies that help to identify and destroy the enemy. The bacterium recognizes the virus by a fragment of its genome in advance - and cuts its DNA into parts exactly in the place where the fragment was found. So in unicellular ones, which have no means of combating infection - neither lymphocytes nor macrophages - a non -similar immunity, an evolutionary device to combat infection was found. Some time later, in 2012, this system of bacterial self-defense was adapted to cut any DNA, including human. And then the doctors already took up it.
What tools make such discoveries? Kunin unexpectedly replies to the request to arrange a tour of his laboratory that it would be in vain time spent: “You have already seen computers in your life, right?” By analogy with theoretical physics, which during the atomic bomb suddenly turned out to be more important than experimental, the Kunin science area is called theoretical biology, but he prefers to use the word computation - “computational”.
“There is a very large part of the biology now Computation , because we have a huge amount of all kinds of data on the genome of the genome, on the expression of genes, by proteomy, by mutations. They can be analyzed using algorithms and computer programs, which we do. And it is precisely these data that are the material of verification of any theoretical models. ” Sykens is a sequence of those very letters of DNA, expression - how DNA turns into protein, and the proteomic deals with the variety of proteins themselves. One single cell, thus, produces at least four sets of data in gigabytes.
Although Kunin graduated from the Biofak of Moscow State University and defended his candidate in virology, his scientific articles are in places in places in places of mathematics - “Hidden Markov Models”, “Butsrap” and “Clastorization” are found there and then. Or the work of a structural linguist: the same “hidden Markov models” are most actively used in modeling a natural language. DNA analysis is similar to analysis of the text not only by the fact that there and there are letters.
When in 2011 Kunin’s 500-page “Logic of chance” came out in English, biologists in Russia did not wait for some publishing house to gather to print it in Russia. Volunteers - about two dozen were hired - in the “Live Journal” they agreed to share the chapters between themselves and sat down for the translation. Kunin, for whom all this was a surprise, remained to make sure that his ideas were conveyed carefully. Three years later, the translation reached a gigantic paper for scientific work with a circulation of 2500 copies - so many readers are not released by the Biofac Moscow State University, probably, in ten years. The author himself refuses to consider his work by the popular science text addressed to people who are beyond the power of original scientific articles: ““ Logic of chance ”is not quite scientific. This is generally a book for those who read articles in Nature , and often writes. But only on its subject. "
In addition to advanced readers today, the book was supposed to have addressees - who, however, have no opportunity to read it: those who 160 years ago, after the release of the “origin of the species” of Darwin, put forward the most sensible claims to his theory. In 1859, Darwin did not know anything about genes and mutations, the gears of the very processes of variability and selection that he described. Therefore, at least it is interesting to object to his critics from the height of today's knowledge. On the other hand, he did not know anything about any viruses either, so the question of how they could appear parallel to cellular life, did not force him to sleep with a restless sleep. And it makes modern biologists.
In general, the problem of the origin of life turns into a paradox only if you know something about biomolecules. Answer the question "What happened before - chicken or egg?" Allows ownership of the theory of evolution in the volume of the seventh class: there used to be a dinosaur. But this question catches up with you in a new quality when it comes to more fundamental things. It was enough for Darwin to write about the “small warm pond”, where molecules in chemical reactions were more complicated in chemical reactions and in the end something was living. We now know: the basis of life is molecules that can copy themselves, they are replicators. DNA molecules are needed for this at least protein from which carcasses of cells are made. And to the proteins to be born, DNA and RNA. Which of them was before - a copy car or what they copy? How did it happen that before the first act of copying in some “warm pond” there were molecules, unlike chemically, but at the same time perfectly fitted to each other?
Until now, this problem could take place in the category of idle curiosity, but then astronomers began to open planets in the inhabited zone of other stars hundreds. The last such news is about as many as seven potential copies of the Earth in 40 light years from us.
Is there life there? Kunin doubts: “From my point of view - and this point of view is quite unpopular - it is not there. It arose on Earth, and, of course, in an endless universe, it arose an infinite number of times. But it is reasonable to expect that our neighbors are extremely far from us. In no sense, in 40 light years. ” Why so? Because this requires too successful a combination of successful circumstances. “It is difficult to come up with a significantly different chemistry. We know very well the distribution of elements in the universe, at least in our part of the Universe. We know what can be expected from this, and what is impossible. In the point of view of chemistry, the non -aggravated life is extremely difficult to imagine. Organic chemistry - it, in general, is one, no matter what we look for there. Specific amino acids, nucleotides and other things can be different. But, in general, freedom is not very great. ”
How to find out the limits of freedom that evolution gives? Take a closer look at microbes. Darwin built his conclusions on observations of the at blizzards and boobs of the Galapagos Islands, but for Kunin these animals (and even more so the case of a person and monkeys) are too complex and too uninteresting compared to unicellular ones. These latter have a frantic speed of generational change and incredible selection pressure. They can also afford, for example, to easily steal from other types of DNA and build into their own (this is called the “horizontal transfer of genes”) - a skill that multicellular like we have lost us. To survive, microbes have to save, first of all, on DNA and make it much more effective than ours. Instead of bringing to perfection, intracellular chemistry, complex organisms have come along the path of least resistance: there are not enough functions - you need to add more cells and add the code. The limit of such a non -amonated DNA design is placed only by the costs of managing it. Genetical and regulatory networks begin to behave like a bloated administrative apparatus and spend all the system resources on themselves-this is the “bureaucratic ceiling of complexity” mentioned earlier.
“Bureaucratic ceiling” is an example of how other planes of human experience suggest ideas for describing evolution. Another important source of such ideas for Kunin is cosmology and statistical physics. One and the other also describe the birth of complexity from chaos in its own way: here, shapeless steam turns into the right six-pointed snowflakes, there, filled with hot plasma after a large explosion, gives rise to spiral galaxies scattered around the space.
These analogies lie on the surface, but Kunin goes further and discusses about evolutionary processes in terms of temperature, entropy and phase transitions. For example, the equations of statupisms begin to acquire a biological meaning if the form of the approval of the species for the so -called free energy, and the size of the population for the temperature. In this sense, the evolution of microbes is a “hot” process, and the evolution of people or elephants is “cold”: compared with the intestinal sticks, there are too few of us in the population so that the selection is eliminated from DNA ineffective. Compared to the genome of the virus, Kunin, ours, the human, the genome, as a result, is simply “poorly designed”. Or, as one of the translators of the book Georgy Lyubarsky summed up his reasoning, “complexity is a genome disease that is not cured by too weak the selection pressure.”
All materials of the project:
Nobel laureate Eric Kandel: "The brain is a sacred thing, you can’t play with it"
Linguist Stephen Pinker: "I just say that biology is important"
Neuropsychologist Michael Gazzaniga: “I am talking to you, not your brain”
Theoretical physicist Lisa Randall: "A handle with paper plays a role"
Anthropologist Robin Dunbar - about why you have five real friends
Anthropologist Pat Shipman: "It seems to be like people, but not people"